<audio src= "http://www.benjaminhorak.com/odysseyjam/HyperionsWake_title.ogg" "http://www.benjaminhorak.com/odysseyjam/HyperionsWake_title.mp3" autoplay loop> </audio> {(live: 1s)[ (stop:)(t8n: "dissolve")[(align: "=><=")[<span style="font-size: 50px; color:#fffac6; font-family: 'Cinzel Decorative', cursive; color:yellow">Hyperion's Wake</span>]]]}{(live: 2s)[(stop:)(t8n: "dissolve")[(align: "=><=")[<span style="font-size: 20px; color:white">by Benjamin Horak]]]} {(live: 3s)[ (stop:)(t8n: "dissolve")[(align: "=><=")[<i>Love, ambition, sea monsters and algae!</i> <hr> <span style=" font-size:20px">An interactive fiction story inspired by book 12 of Homer's <i>The Odyssey</i> and was developed during the #OdysseyJam. Set in a science fiction world a 1,000 years into the future, <i>Hyperion's Wake</i> uses themes from Homer's oceanic epic for a new story.</span> <hr> <span style=" font-size:20px; color: yellow;"><i><b>A work in progress and is currently not finished. For best experience, run game on a desktop verion of Chrome or Firefox with headphones.</i></b></span> <hr> <span style="color:orange; background-color:silver; font-size:30px">(align: "=><=")[[[START|quote]]]</span> ] ] ]} (align: "=><=")[<span style="color:orange; font-family: 'Jim Nightshade', cursive; font-size:40px; line-height: 200%;"> {(live: 1s)[ (stop:)(t8n: "dissolve")[(either: "The whole abyss lay bare and the rocks around her roared.")]]} {(live: 4s)[ (stop:)(t8n: "dissolve")[ (either: "terrible deafening — ashen terror gripped the men.")]]} {(live: 6s)[ (stop:)(t8n: "dissolve")[ (either: "now, fearing death , all eyes fixed on Charybdis.")]]} {<span style="color:silver; font-size:20px; font-style: italic;">} {(live: 8s)[ (stop:)(t8n: "dissolve")[ (either: "—Book 12 of The Odyssey")] ]</span>} {(live: 15s)[ (goto: "intro") ]} ] <audio src="http://www.benjaminhorak.com/odysseyjam/padtest3.ogg" "http://www.benjaminhorak.com/odysseyjam/padtest3.mp3" autoplay> </audio> Dr. Gregor was a tall man, in his late sixties, he wore a white fitted tunic. with a powerful stance that defied his age, he stood in Ulysses and Yasu's lab ship, looking over their research with interest, he adjusted quickly to the heat of the planet. He was heat, Ulysses thought, too look on him was to look into the sun. "I can't believe your were stranded here for three days, I was passing through this system when I heard your call." | [["I am sorry for our appearance"]] | [["Thank you so much"]] | (text-style: "strike")["I'm sorry I failed you"] |(if: $storyStage is "hyperspace")[ Ulysses and Yasu entered the large curved dining room of the Hyperion's Wake. The ship's superstructure was coated in brass, an old tradition of marine lab ships. Before them a feast of roasted lamb and chicken, steamed asparagus, biscuits and mashed potatoes seasoned in garlic sat on the massive metal dining table, [[Gregor Neleus]] at one end, eating his steamed asparagus. "Good god," Yasu squealed, "we haven't eaten like this in years!" Ulysses mouth watered, it was true, he had not eaten like this since his wedding day with Yasu, he had forgotten about that. The feast was a message from Dr. Gregor Neleus. His vast wealth came from science awards, grants and bio drug research. He was on top of the food chain and Ulysses knew it. | [[Corridor]] | ] <audio src="http://www.benjaminhorak.com/odysseyjam/hyperion_wake.ogg " "http://www.benjaminhorak.com/odysseyjam/hyperion_wake.mp3" autoplay loop> </audio> ulysseys wakes to hear a strange banging sound against the bow of the ship tries to call for someone. the monsters risethe enzyme is sent into the ocean, making the natural algae turn yellow matching the sunset.Ulysses has to choose over his work and Yasumultile ways of his death based on past decisions.Name of the shuttle or ship that finds them is Calypso.Ulysses chooses his path with Yasu.His mind was fixed on a computer readout, looking for keys to a puzzle with no end, his sharp dark eyes cutting through data as a chef fillets a fish. His only way of deafeating the sweltering air, he brushes away a few stray curly brown hairs from his face and re-focuses, his round jaw grinding down on Acuria seeds, his gentle face squished together as the tartness takes hold. [[&#10095; Enter Yasu|fish]] Yasu Akiyama walked into the lab, a victim to the heat, her small frame moved lightly along the metal floor as if she were half evaporated, she had removed her lab coat and shirt in favor of a blue cropped top and black shorts, soaked not in the red sea but in her own sweat, her black shoulder length hair was tied in a pony tail and pulled upward to give her lightly brown neck the hope of a cool zepher. [[&#10095; Data crunch|zepher]] <audio src="http://www.benjaminhorak.com/odysseyjam/computer_Process.ogg " autoplay> </audio> (t8n: "dissolve")[ Her arrival was chimed by the A4-Bio Processor's announcement.] <span style="font-size: 25px; color:red; font-family: 'Oxygen Mono', monospace; color:red;"> {(live: 2s)[Sequence Complete]} {(live: 3.5s)[Chromosome 12.987.456 nt]} {(live: 4s)[Extra-Chomromsome element 1 67.897 nt]} {(live: 4.5s)[Extra-Chomrosome element 2 45.342 nt]} {(live: 5s)[total number of matched pair ends 55,765]} {(live: 5.5s)[Average read length 512]} {(live: 6s)[Fold Coverage 19.4]} </span> {(live: 7s)[[[Ulysses shrugged.|damn]]]} { (print: "<script>$('html').removeClass(\)</script>") (if: (passage:)'s tags's length > 0)[ (print: "<script>$('html').addClass('" + (passage:)'s tags.join(' ') + "'\)</script>") ] }Namera. An ocean planet. Red algae spreads across the entire ocean surface, coating the water with a blood-rusty varnish. It's meek waves simmer in the summer solstice. As the horizon melts into the yellow sky a lone research ship crawls through the water slowly, it's powerless wake leaves a thin pale blue string of churned water, as if it were unraveling the sea. With a full compliment of computers, test tubes, sweat and ambition, it was a floating laboratory. But the ship was adift, it's emergency beacon chiming away the hours. The heat radiated off of the water with such intensity it could have melted anyone's thoughts away, but not Ulysses. [[&#10095; Go into the lab.|En Media Res]] <audio src="http://www.benjaminhorak.com/odysseyjam/namera_outside.ogg " "http://www.benjaminhorak.com/odysseyjam/namera_outside.mp3" autoplay> </audio>"I know it's only been three days, but I would like to know that we are going to have a vacation within the next...you know...thousand years?" Yasu was determined, she hated being stranded, she hated the heat of this planet. She was an exo-phycologist, an expert of alien algae. It was not her first love, she wanted to work with animals, but an early encounter with a snapping turtle and a trip to the hospital put her college efforts into a biology science that would not run the risk of a severed tendon. | [["Yeah..."]] | [[Continue to ignore her|Look over data]] | (text-style: "strike")[Your beautiful] "Yeah? Yeah meaning we need to get rescued? or yeah we need a vacation?". Ulysses didn't respond for a moment. "Ulysses?" Yasu stepped closer to Ulysses her foot hit the ground and the entire ship began to rumble. Glass tubes clanged together as loose tools began to find their way off their tables, crashing into the metal floor, the air began to hum in a horrible rumble. "Oh my god its a ship!" Yasu dove for the top deck of the ship. | [[Hail the ship]] | [[Follow her|Go outside]] | Ulysses knew he needed a different sample to make the protein fit properly, looking across his table, he only had two samples left to test. | [[Try Enzyme-894]] | [[Try Enzyme-1145]] | Ulysses reached the top deck and met beside Yasu, her hair untied from being blown in the massive wind form the ships exhaust, the blazing sun blinded him, shielding his eyes he looked up to see a massive ship landing into the water. The power of the engines began to quiet down as the pilot eased off of the drive core, plunging the craft into the crimson waters. The name of the ship was cast in bronze and welded into the bow, the Hyperion's Wake. In that instant, Ulysses knew who's ship this was, there was no mistaking it. The ship was owned by Dr. Gregor Neleus, his old teacher, the foremost top exo-biologist of his time, many of his colleagues hated [him]<him|. (click: ?him)[ [[&#10095; Ulysses wanted to be him.|To Solmaeta]]] <audio src="http://www.benjaminhorak.com/odysseyjam/namera_outside.ogg " "http://www.benjaminhorak.com/odysseyjam/namera_outside.mp3" autoplay> </audio><span style="font-size: 25px; color:red; font-family: 'Oxygen Mono', monospace; color:red;"> Sequence Initialed - {(live: 1s)[AGAGTAGCCCAGAGGAGGATTAGACTAGAGTAHACAGTCCCATGA]} {(live: 2s)[CCCCAGAGTCCAATAGTATATAGADDATAGCTGATCATACCTTAC]} {(live: 3s)[GGTACTGTGTAATCTCGGATTAGAGCGCCGTGTATGTGGAATATA]} {(live: 4s)[TTATAGGACCTCATCACAAAATTTGCAGTAGTTACCCCAAATTGG]} {(live: 5s)[Sequence Complete]} {(live: 5.5s)[Chromosome 12.987.456 nt]} {(live: 6s)[Extra-Chomromsome element 1 67.897 nt]} {(live: 6.5s)[Extra-Chomrosome element 2 45.342 nt]} {(live: 7s)[total number of matched pair ends 55,765]} {(live: 7.5s)[Average read length 512]} {(live: 8s)[Fold Coverage 7.1]} </span> {(live: 10s)[[["Damn." Hissed Ulysses, it was not a match.|894]]]} <audio src="http://www.benjaminhorak.com/odysseyjam/computer_Process_2.ogg " autoplay> </audio> <audio src="http://www.benjaminhorak.com/odysseyjam/computer_Process_2.ogg " autoplay> </audio> <span style="font-size: 25px; color:red; font-family: 'Oxygen Mono', monospace; color:red;"> Sequence Initialed - {(live: 1s)[AGAGTAGCCCAGAGGAGGATTAGACTAGAGTAHACAGTCCCATGA]} {(live: 2s)[CCCCAGAGTCCAATAGTATATAGADDATAGCTGATCATACCTTAC]} {(live: 3s)[GGTACTGTGTAATCTCGGATTAGAGCGCCGTGTATGTGGAATATA]} {(live: 4s)[TTATAGGACCTCATCACAAAATTTGCAGTAGTTACCCCAAATTGG]} {(live: 5s)[Sequence Complete]} {(live: 5.5s)[Chromosome 8.154.136 nt]} {(live: 6s)[Extra-Chomromsome element 1 17.624 nt]} {(live: 6.5s)[Extra-Chomrosome element 2 23.421 nt]} {(live: 7s)[total number of matched pair ends 77,112]} {(live: 7.5s)[Average read length 325]} {(live: 8s)[Fold Coverage 20]} </span> {(live: 10s)[[["Ha! A match!"|1145]]]} {(live: 7s)[(goto: "dr neleus")]}(align: "=><=")[<img src="http://www.benjaminhorak.com/odysseyjam/TheSequence_Title.gif">] <audio src="http://www.benjaminhorak.com/odysseyjam/TheSequence.ogg " "http://www.benjaminhorak.com/odysseyjam/TheSequence.mp3" autoplay> </audio> Damn, the fold coverage isn't right again," Ulysses sighed. {(live: 2s)[Have you heard anything from the distress call?" Yasu was fanning her face.]} (click: "face")[| (text-style: "strike")[Let's have a break together] | (text-style: "strike")[Let's take a dip in the sea] | [[Ignore her]] |] It took him 17 days to find the right protein. Now he could celebrate. Ulysses clapped his hands together in one loud bang, the ground and the entire ship began to rumble. Glass tubes clanged together as loose tools began to find their way off their tables, crashing into the metal floor, the air began to hum in a horrible rumble. "Oh my god its a ship!" Yasu dove for the top deck of the ship. | [[Hail the ship]] | [[Follow her|Go outside]] |He slammed his fist into the table, the entire ship began to rumble. Glass tubes clanged together as loose tools began to find their way off their tables, crashing into the metal floor, the air began to hum in a horrible rumble. "Oh my god its a ship!" Yasu dove for the top deck of the ship. | [[Hail the ship]] | [[Follow her|Go outside]] |Dr. Neleus leaned against a table, his lips moved into a smile as he pulled a small bio-chip form his tunic pocket. The chip was clear with red bio-gel circuitry inlaid inside it. A little treasure. "A bio-chip?" Ulysses was trying to process what this was about. "Oh, this is more than just a bio-chip," Dr. Neleus spoke with a stern conviction, "this is the future of biology, of the human race, this changes everything." The doctor hands the chip to Ulysses. | [[Put it in the A4-Bio Processor|"Can I take a look?"]] | The A4-Bio processor grinded a trillion calculations a second, a large flat black plate beside the machine began to change shape, its nano-pixel particles arranged themselves in three dimensions manifesting the computer's processes in real time. Like a recipe book, combining atoms into molecules and molecules into proteins a peculiar structure began to form. Ulysses eyes were wide. "A bio sequence?" "Yes," said Dr. Neleus with a smile. "One of the most complex I have ever come across." The A4-processor continued to churn out the calculations, the usual sequences that Ulysses processed only took a few moments for their structures to be fully analyzed. But this was massive, the sequence continued to grow into a dense thicket of ribbons folding in and out of each other. Ulysses had never seen such complexity in a single sequence before. Wherever this came from, it could not have been made in a lab he was sure of it. And then he saw [[it.]] <audio src="http://www.benjaminhorak.com/odysseyjam/a4_bio_processor.ogg " "http://www.benjaminhorak.com/odysseyjam/a4_bio_processor.mp3" autoplay loop> </audio> "Human" Ulysses whispered. Dr. Gregor Neleus smiled, he knew Ulysses was the only one who could spot such a small detail. "Human?" Yasu said with disbelief, "No way! look at it?!" Dr. Gregor Neleus only smirked and nodded. The sequence did have an element of human DNA. But how could that be?, where did Dr. Neleus really find this thing? Ulysses was at a loss, "How?" Dr. Neleus leaned toward Ulysses, "I will show [[you.]]" {(live: 4s)[(goto: "Observation")]}(align: "=><=")[<img src="http://www.benjaminhorak.com/odysseyjam/HyperionsWake_Title_fade.gif"> ] <audio src="http://www.benjaminhorak.com/odysseyjam/hyperionswake.ogg " "http://www.benjaminhorak.com/odysseyjam/hyperionswake.mp3" autoplay> </audio> (set: $storyStage to "hyperspace") Moving across the stars in hyperspace, the Hyperion's Wake made no stops, it would reach the planet of Solmaeta within moments. Ulysses stood inside observation deck, Yasu sat next to the large circular window and watched the stars pass. They were marooned on a lonely planet for days, now there were going to another one. Looking into an elaborate display case, Ulysses glared at the medals, awards and photographs of celebrities being candid with the owner of the ship, Dr. Gregor Neleus. "Do you think he polishes these awards every night?" Yasu didn't respond she was slumped across a bench overlooking the void. Space travel made her irritable and a bit bored, "He probably sleeps with them, who cares, I'm just glad we are of the that bloody hell hole, we should check out the rest of the ship." | [[Step into the corridor|Corridor]] | <audio src="http://www.benjaminhorak.com/odysseyjam/hyperion_wake.ogg " "http://www.benjaminhorak.com/odysseyjam/hyperion_wake.mp3" autoplay loop> </audio> (if: $storyStage is "hyperspace")[ Walking down a long thin hallway that housed each crew quarters, their [[guest quarters]] were on the far end of the claustrophobic hallway. Most of the crew were on duty or sleeping and locked their rooms down. The sound of low, [[slow music]] filled the hallway. | [[Return to corridor|Corridor]] | ] <audio src="http://www.benjaminhorak.com/odysseyjam/hyperion_wake.ogg " "http://www.benjaminhorak.com/odysseyjam/hyperion_wake.mp3" autoplay loop> </audio>(if: $storyStage is "hyperspace")[ The bridge was much smaller than expected, fitted for only two people, it was packed with glittering computer displays, nanographic models of space terrain and small port-hole sized windows. That was to be excpected this, ship was designed to work in space and at the depths of deep dark oceans. The pilot was busy working the comms with the engineer and navigator. (live: 5s)["(either: "Pull off on T7, on mark 3.", "Initiate aft thruster warm-up sequence.", "Ok, O-2, 7 pull on T5.", "Steven, do you have those read outs on sector 56.980.?", "Ok, aft thruters look good.", "Set drive core, mark 88.", "Jacob, what's your intake reading?", "Man, do I need to piss." )"] | [[Return to corridor|Corridor]] | ] <audio src="http://www.benjaminhorak.com/odysseyjam/hyperion_wake.ogg " "http://www.benjaminhorak.com/odysseyjam/hyperion_wake.mp3" autoplay loop> </audio>(if: $roomSet is "true")[ The room was unfolded and set with funishings, Yasu's clothes were piled on the bed. A few reasearch pads were scattered across the table. | [[Return to corridor|Corridor]] | ] (else:)[ Arriving at a small alcove, their room was not setup yet. I guess they didn't have time for us, Ulysses thought. "Should we setup our own room?," Yasu ventured into the alcove. A small flat [[panel]] was fitted to one wall, the other walls held shelving with sealed containers labeled: bedding, table cloths, cushions and vases. | [[Back to corridor|Corridor]] | ] <audio src="http://www.benjaminhorak.com/odysseyjam/hyperion_wake.ogg " "http://www.benjaminhorak.com/odysseyjam/hyperion_wake.mp3" autoplay loop> </audio>They reached the source of the music, a door was half open, revealing a large man in grey body armor, he sat in his chair with his legs up reading the latest issue of <i>Brute Force</i>. A small photograph and a candle were lit on the table beside him, a bottle of whisky was half full. He was humming to himself, the music did not seem joyful. His name was Nestor but his closest friends called him Mulely. "Excuse us," Yasu gently spoke as if not to disturb him. "What is it?" Nestor spoke with a quiet gritty voice, he did not even look up from his magazine. Ulysses spoke harder, "We are the new scientists on board." "Welcome aboard, why don't you have a drink?" | [["Sure."]] | [["Perhaps we should find our room first"]] | <audio src="http://www.benjaminhorak.com/odysseyjam/hyperion_wake.ogg " "http://www.benjaminhorak.com/odysseyjam/hyperion_wake.mp3" autoplay loop> </audio> (set: $nestorStory to "yes") "We can have a drink? Right Yasu?" Yasu froze a little, she was not sure why she was drinking with this man, who could probably kill them in his drunken state. "Yes, Yes, Yasu," he closes his eyes why saying her name as if imagining another woman, "sit down and drink." Nestor poured more glasses of whisky he seemed to begin to cheer up. "My name is Nestor," he spoke, "I'm the security chief on this little ship, I'm here to make sure any pirates don't come for us in our sleep." "Thats reassuring." Ulysses begain to regret walking into this [[room]]. <audio src="http://www.benjaminhorak.com/odysseyjam/hyperion_wake.ogg " "http://www.benjaminhorak.com/odysseyjam/hyperion_wake.mp3" autoplay loop> </audio> "Perhaps we should find our room first." "There is no whiskey in there, I know, I checked." Nestor hickuped. [[Have a drink with Nestor|"Sure."]] | [[Back to corridor|Corridor]] | <audio src="http://www.benjaminhorak.com/odysseyjam/hyperion_wake.ogg " "http://www.benjaminhorak.com/odysseyjam/hyperion_wake.mp3" autoplay loop> </audio>(if: $storyStage is "hyperspace")[ A large window framed the deep dark deeps of the Solmaeta ocean, it was called Ob by the people who lived on the planet. The empty void of the ocean was the same as the void of space, the only way Ulysses could know is by the pulsing of the hypercore engines. Most of the equipment was powered off, a safety precaution while traveling through space. | [[Back|deck 3]] | ] <audio src="http://www.benjaminhorak.com/odysseyjam/hyperion_wake.ogg " "http://www.benjaminhorak.com/odysseyjam/hyperion_wake.mp3" autoplay loop> </audio>(if: $storyStage is "hyperspace")[ The port door to the top deck was sealed, the red warning light confirmed it, Ulysses thought about the ramications of opening the door during hyperspace flight, how long would he live before his blood boiled? | [[To deck 2|Corridor]] | [[Aft engine hatch|Aft Engine Room]] <audio src="http://www.benjaminhorak.com/odysseyjam/hyperion_wake.ogg " "http://www.benjaminhorak.com/odysseyjam/hyperion_wake.mp3" autoplay loop> </audio> ](if: $storyStage is "hyperspace")[ The storage sample bay was locked. | [[Back|deck 3]] | ] <audio src="http://www.benjaminhorak.com/odysseyjam/hyperion_wake.ogg " "http://www.benjaminhorak.com/odysseyjam/hyperion_wake.mp3" autoplay loop> </audio>(if: $storyStage is "hyperspace")[ The aft engine room door was sealed, the engine propelled the ship through water and was powered down, while in space travel. | [[Back|Corridor]] | ] <audio src="http://www.benjaminhorak.com/odysseyjam/hyperion_wake.ogg " autoplay loop> </audio>(if: $storyStage is "hyperspace")[ The elevator slowly pushed downwards into the lower deck of the ship. Submersed into the ocean, the wet lab and accompanied storage sample bay was also a detachable submersible if the need arises to go down a few miles and collect a few specimens. | [[Go to wet lab|Wet Lab]] | [[Storage Sample Bay|Storage]] | [[Deck 2|Corridor]] | ] <audio src="http://www.benjaminhorak.com/odysseyjam/hyperion_wake.ogg " "http://www.benjaminhorak.com/odysseyjam/hyperion_wake.mp3" autoplay loop> </audio>(if: $storyStage is "hyperspace")[ The corridor was unusually quiet, most of the crew were either sleeping or working on the bridge, the walls pulsed with the pumping of the hypercore engine. | [[Dining hall|The Dining Hall]] | [[Your cabin]] | [[Bridge]] | [[Lower deck|deck 3]] | [[Aft engine room|Aft Engine Room]] | [[Main engine room|HyperCore Drive Engine]] <audio src="http://www.benjaminhorak.com/odysseyjam/hyperion_wake.ogg " "http://www.benjaminhorak.com/odysseyjam/hyperion_wake.mp3" autoplay loop> </audio> ] (if: $storyStage is "hyperspace")[ The door was sealed down, the massive pulse of the hypercore drive engine was the heart of the Hyperion's Wake. It was certinaly off limits to only the engine crew. | [[Corridor]] | ] <audio src="http://www.benjaminhorak.com/odysseyjam/hyperdrive_core.ogg " "http://www.benjaminhorak.com/odysseyjam/hyperdrive_core.mp3" autoplay loop> </audio> (set: $storyStage to "sirens") "Ah, there are you are," he said cheerfully chewing fiercely, "You are both welcome to join me, we have a few days ahead of us." "A few days?" Ulysses did not know how long he would be on this expedition. "Yes just a few, the navigator has spotted a storm brewing in the region we are headed." Gregor was not particularly concerned with the storm, he was going over the results of his last experiments on his pad. "Did you meet Nestor, our security chief?" he asked. {(if: $nestorStory is "yes")[ "Yes, a sad fellow, he talked about some trouble with some interesting fish." "Ah, yes the siren fish seem to have made a few delays to our field studies last time, ha." he bit into a piece of chicken. "So a storm is coming?" "The Solmaeta ocean is quite a finicky beast, one day its as calm as a summer spring, then a raging bull the next." He plopped his fork down in exchange for a buttery [[biscuit]]. ]} {(else:)[ "No, we did not meet him." "Well best if you don't, he is going through a few issues, I recommend that you don't bother him ok? | [["Ok"|biscuit]] | ]} <audio src="http://www.benjaminhorak.com/odysseyjam/hyperion_wake.ogg " "http://www.benjaminhorak.com/odysseyjam/hyperion_wake.mp3" autoplay loop> </audio>(set: $roomSet to "true")[ Ulysses placed on hand on the panel and pushed forwards, the wall began to move. He made careful baby steps as the wall separatd into cut out shapes, a table, a chair, and a bed unfolded themselves from the cool smart metal wall, in one moment the room had expanded into a bedroom. Once folded out, the smart metal self-healed the seams into one continuous structure. Yasu began choosing her bedding and decor. ] | [[Return to corridor|Corridor]] | <audio src="http://www.benjaminhorak.com/odysseyjam/hyperion_wake.ogg " "http://www.benjaminhorak.com/odysseyjam/hyperion_wake.mp3" autoplay loop> </audio>Ulysses reached for his comms unit on his wrist, with a push of a button he spoke into it. "Hello, Hello is there any body there?" A low voice commanded over the static, it was the pilot. "We are go for landing sequence initiation, aft burners are hot." | ["Hello? Hello?"]<ship| | [[Go outside]] | (click: ?ship)["Looks like there is a woman on deck doctor. Jacob push the aft burner off, we are listing five degrees. "] <audio src="http://www.benjaminhorak.com/odysseyjam/Radio_Comms.ogg " "http://www.benjaminhorak.com/odysseyjam/Radio_Comms.mp3" autoplay> </audio> "I am sorry for our appearance," Ulysses blushed, for he had not shaved this whole time. "I can see you are ruffing it." Dr. Gregor was more kind than usual, Ulysses remembered the doctor grinding him for having a shirt untucked during class. Why was he so yielding now? "I hope you can take us with you?" Yasu said with genuine zeal, her hands clasped together as if she was ready to beg. "Of Course!" the doctor smiled, but I can't take you back to Earth right away." Ulysses frowned, he was not going back to Earth? "Where are you going now?" Dr. Gregor Neleus smiled, oh I think you will like it much better where we are heading, I could really use both of you right now, your misfortune is my gain." He chuckled a little. He had a [[plan]]. "Than you so much, for coming to our aid." Yasu said with genuine zeal. I hope you can take us with you?" "Yes, but I can't take you back to Earth right away." Ulysses frowned, he was not going back to Earth? "Where are you going now?" Dr. Gregor Neleus smiled, oh I think you will like it much better where we are heading. I could really use both of you right now, your misfortune is my gain." He chuckled a little. He had a [[plan]]. The comms unit crackled to life. "Sir we are landing now," the pilot said. "Excellent, why don't you and Yasu come join me in the [[Observation deck?|Observation siren]]" <audio src="http://www.benjaminhorak.com/odysseyjam/Radio_Comms.ogg " "http://www.benjaminhorak.com/odysseyjam/Radio_Comms.mp3" autoplay> </audio> <audio src="http://www.benjaminhorak.com/odysseyjam/hyperion_wake.ogg " "http://www.benjaminhorak.com/odysseyjam/hyperion_wake.mp3" autoplay loop> </audio> The blue water of the Ob ocean on Solmaeta, was a refreshing site after seeing endless bloody water on Nemera. The Hyperion's Wake plunged into the water with force. Ulysses, Yasu, and Gregor watched from the observation deck as the window before them overlooking the ocean was then submerged, a mist of bubbles dissolved revealing the sea life below. Large pale fish striped in yellow with bulbous square heads swam closer to the window. Their large dark eyes stared into them, as if they knew who they were, then more peculiar fish appeared in the window, then a hundred. Gregor crinched, "We landed right in their blasted school, Pilot! Pilot get the drive core back online!" Gregor ran up to the bridge, but it was too late, the fish swarmed into a frenzy, a low hum and growl vibrated the ship, Ulysses could feel a static charge in the air. And then the blast came. [[&#10095; Siren's Call|fishdanger]] <audio src="http://www.benjaminhorak.com/odysseyjam/hyperion_wake.ogg " "http://www.benjaminhorak.com/odysseyjam/hyperion_wake.mp3" autoplay loop> </audio> Nestor began again, "I have had to bury my friend today, shot his body right out into space, before picking you up." Ulysses now really regretted coming into this room, "I'm sorry to hear that." "We were on the waters of Solmaeta, looking for your enzymes." Nestor stared at the small photograph on the table, it was a picture of Nestor, his arm around another man who was blonde, skinny but muscular, they both had a wide grin on their faces, a large mass of a dead lizard was bound and hung from a hook, the scaly body was just as tall as the men, it was a glorious [[kill]]. <audio src="http://www.benjaminhorak.com/odysseyjam/hyperion_wake.ogg " "http://www.benjaminhorak.com/odysseyjam/hyperion_wake.mp3" autoplay loop> </audio>"But we saw a few things you woudn't believe," he spoke as he drew the whiskey to his lips, which nearly leaped out from the glass as his fingers trembled. "A few days in we heard the sounds of some kind of whale, but it was high pitched it was not even really a whale at all it was some kind of fish." Nestor's expression was one of wonder and terror. "Those fish make some kind of sound that distrupted the systems on the ship, we had to wait for them to leave us before we could move out again." | [[Corridor]] | <audio src="http://www.benjaminhorak.com/odysseyjam/hyperion_wake.ogg " "http://www.benjaminhorak.com/odysseyjam/hyperion_wake.mp3" autoplay loop> </audio>Then the power went out. The emergency generators came online, red warning lights and alarms charged the air. "We need to get the ship out of here!" screamed Yasu. She was right but how?, the main power was offline. Ulysses need to figure something out. | [[Run into the corridor|Corridor2]] | <audio src= "http://www.benjaminhorak.com/odysseyjam/Sirens.ogg" "http://www.benjaminhorak.com/odysseyjam/Sirens.mp3" autoplay loop> </audio> (if: $storyStage is "sirens")[ The corridor was filled with crewmen running to their posts. The ship was listing to one side, it's main engines were offline, the craft was sinking into the depths. The terror that swarmed the ship was mirrored into the faces of the crew, they did not know death, they had not trained for total disaster. He had lost track of Yasu in the chaos, this is it, he thought. Ulysses braced himself, then ran for the bridge. [[&#10095; Hyperion's Peril|end]] <audio src= "http://www.benjaminhorak.com/odysseyjam/Sirens_noblast.ogg" "http://www.benjaminhorak.com/odysseyjam/Sirens_noblast.mp3 " autoplay loop> </audio> ][(align: "=><=")[This is the end of part 1. Thanks for playing this gamejam, if you liked it or had thoughts on how to improve it please let me know. Thank you.] [[Start Over|Start Screen]]